Article Type: Research Article Article Citation: María Emilia Vidargas Rubio, Dra. Iliana Herrera, Dra. Abigail Valdes -Bartolo, and Dra. Ivette Buendia-Roldan.
(2021). CORRELATION OF TELOMERE LENGTH SHORTENING WITH SMOKING. International
Journal of Research -GRANTHAALAYAH, 9(1), 211-215. https://doi.org/10.29121/granthaalayah.v9.i1.2021.3113 Received Date: 02 January 2021 Accepted Date: 31 January 2021 Keywords: Telomeres Telomere Length Active Smoking Passive Smoking RT-CPR Background: Telomeres are DNA sequences that can be found at the ends of chromosomes, and prevent them from being damaged, they show shortening every time with the cell division, and when it is below a minimal length, the cells interrupt their cell cycle. Cigarette smoke contains chemical compounds that contribute to the oxidative damage in cells. Method: subjects over 65 years old belonging to the INER ageing cohort, residents of Mexico City and asymptomatic respiratory patients were studied. A questionary was applied on demographic characteristics, smoking habits (active and passive), and the study groups were identified as active smoking (AS), passive smoking (PS) and non-exposed subjects (NE). Telomere length was measured in a serum sample using the quantitative method based on RT-PCR. Results: We compared clinical data and telomere length of 333 subjects, showing that non-exposed group are below the 10th percentile, with the smallest telomere size (NE 1.38 + 0.36 vs PS 1.50 + 0.40 and AS 1.41 +0.43). Conclusion: There is no evidence that telomere shortening have increased as a result of active or passive smoking. It is suggested that smoking is not the only one responsible for the presence of shorter telomeres.
1. INTRODUCTIONTelomeres
are repeating DNA sequences that can be found at the ends of eukaryotic
chromosomes and prevent them from breaking or being damaged. These DNA
sequences are highly conserved, with tandem repeats (TTAGGG) and associated
proteins, they present a special structure that prevents their binding to the
ends of other chromosomes, preventing telomeric fusion[1]. They play
an essential role in the preservation of chromosomal integrity, protecting the
DNA code from enzymatic action and degradation, contributing to the maintenance
of chromosomal stability, and they mediate important interactions between
chromosomes and the nuclear matrix, also achieving effects of the transcription
of genes located in subtelomeric regions and interact
with the regulatory mechanisms of the cell cycle [2],[3]. Currently,
it is considered that a minimal of telomere length is required to maintain
telomere function, when they reach a critical size, they have difficulty
separating during mitosis, generating telomeric associations and chromosomal
instability [4],[5]. The model
proposed about the role of telomeric shortening in ageing and cellular
immortality involves several steps. Telomeric DNA protects the ends of
chromosomes from recombination events and the length would serve as a “mitotic
clock”, which allows exit from the cell cycle when the telomeres become short
enough. The telomeres length, under physiologically conditions, declines with
successive cell divisions, progressively reaching a stage of critical reduction
characteristic of the senescence process[6]. Cellular
senescence is an irreversible process of decline in proliferation in relation
to age. It is an active, genetically programmed process that responds to an
induction given by telomeric shortening, generating a similar signal to the
produced by DNA damage [7]. That is, telomeres are repeated DNA
sequences that are found at the ends of chromosomes and are responsible for
preventing the chromosome from degrading or fusing. In some
lung diseases, such as lung cancer, smoking has been reported as an etiological
cause, however it has been suggested that there may be other factors that
contribute to this causality such as age and genetic susceptibility [8]. Since the
cigarette smoke contains a large number of chemical
compounds, such as oxidative agents and free radicals, it has been suggested
that these agents maximized oxidative damage in the cells, meanwhile the
telomere shortening can balance the exposure to these agents and the
antioxidant capacity of the body. Telomere
length is also an indicator of the biological age of an individual, therefore,
“shorter telomeres associated with increased ageing with all that this
involves”, such as chronic obstructive pulmonary disease (COPD), cardiovascular
diseases and accelerated general deterioration [9]. In this
context, we proposed to study the influence of smoking as the only one
responsible for a higher shortening in the length of telomeres. 1.1. MATERIALS AND METHODS
We
studied 333 randomized selected patients over 65 years of age, who participated
in the protocol of “Functional and structural lung ageing in adults in Mexico
City and early detection of chronic-degenerative respiratory disease” that is
carried out in the research unit of the National Institute of Respiratory
Diseases (INER). The
screening of the patients for inclusion in the study involves a medical
history, a clinical examination, a blood sample and a series of pulmonary
function tests, a questionary was also carried out on demographic
characteristics, smoking habits, cigarettes per day, the number of years that
the person had smoked and the accumulated consumption as a pack-year smoked. We
classified the groups as: active smoking (AS), passive smoking (PS) and
non-exposed (NE). Telomere
length was measured using a quantitative method based on RT-PCR as described by
Cawthon[10]. This technique consists of the polymerase
chain reaction in real time (qPCR). In short,
genomic DNA is extracted from peripheral blood samples of 333 individuals, of
which 113 with active smoking, 110 passive smoking and 110 without exposure,
which served as a control group. The qPCR was done in triplicate with the
genomic DNA extracted from the blood samples and leaving them at a
concentration of 1.5ng/ml, the following reagents were used, power SYBRÒ Green
PCR Master Mix (Life Technologies, UK), RNase-free water (SIGMA, UK), a pair of
primers targeting the single copy gene (S) (36B4d F-300nM), the forward has the
sequence CCCATTCTATCATCAACGGGTACAA and the reverse (36B4u R-300nM)
CAGCAAGTGGAAGGTGTAATCC and another pair of primers called Tel (T), the forward
(900nM) has the sequence CGGTTTGTTTGGGTTTGGGTTTGGGTTTGGGTTTGGGTT and the
reverse (900nM) GGCTTGCCTTACCCTTACCCTTACCCTTACCCTTACCCT. The cycling that was
used was the following: 95ºC for 10 min; 95ºC for 15 s, 58º C for 1min, 72º C
for 30s for 40 cycles; 95ºC for 15 s, 55ºC for 15 s and 95º C for 15 s. This
method provides a relative value for telomere length (T/S radius) by comparing
it with the control curve, which was obtained be extracting DNA from A549 cells
obtained from ATCC (Manassas, VA). Outliers were excluded and the average was
calculated. Descriptive statistics were presented as mean
and standard deviation (SD). The ANOVA test was used to compared among the
three study groups. The correlations between the exposure variables and
telomeric length were calculated using the GraphPad Prism V6 program (Graphpad Software Inc, CA, USA), where the logarithmically
transformed relative T/S ratio was normally distributed. The ANOVA test was
also used to compare smoking habits with telomere length groups. 2.
RESULTS
AND DISCUSSIONS
We analyzed 3 groups: PS (n=110), AS (n=113)
and NE (n=110), the PS group with a mean age of 69+ 9 years old, the AS
group with a mean age of 70 + 16 and the NE group with a mean age of 71 +11.
Of the three groups studied, some associated comorbidities were identified such
as high blood pressure, diabetes mellitus and gastroesophageal reflux disease
(GERD), which although the three comorbidities are not present in all subjects,
they do have at least one associated comorbidity. Table 1. Table 1: General Data in the three groups.
A higher
rate of active smoking was found in male subjects 68% compared to passive
smoking, which were only 9% of men, subjects in the NE group showed the
smallest telomere size (T/S), PS 1.50 + 0.40, AS 1.41 +0.43
versus NE 1.38 + 0.36, there was not statistically significative (p=0.2)
(Fig. 1). Telomere
length was determined using the quantitative real-time PCR technique, plotting
the T/S value of the three groups AS (black diamonds), PS (blue circles) and NE
(red triangles) against this age. The dotted lines represent the 90th
and 10th percentiles the LN (Relative T/S radius) is the natural
logarithm of the T/S radius, where the radius is the number of copies of the
telomeric DNA on the single copy gene. Samples that are below the 10th
percentile will be those with short telomeres, that belongs to NE group. (Figure
2) In the present study we have described the
telomere length in a population divided according to smoking habit to show its
influence, determining that in patients without exposure the shortening was
higher compared to patients with both active and passive smoking, confirming
the results that was previously described by Zoraida Verde9, who
showed that a higher shortening of the length of telomeres is related to other
exposures suffered by the body and not only with the smoking habit. In this
study, we divided the subjects according to active or passive exposure, with
the limitation that while for active smoking there is a formula to calculate
year packages exposure, to passive smoking is more subjective. In our groups,
other associated chronic comorbidities were found that may indirectly influence
telomere length. 3.
CONCLUSIONS
AND RECOMMENDATIONS
Based on our results, we consider that
lifetime exposure to smoking accumulated, whether active or passive could have
a contributing impact on telomere shortening. However, the fact that a person
has other exposures may be more related to a higher shortening of telomeres. We consider that for future studies, the
association between exposures and comorbidities could be taken
into account as causes of oxidation, they could have a greater
relationship with the accelerated shortening of telomeres. Average telomere lengths were not found to be
shortened in subjects exposed to active or passive smoking compared to those
not exposed. Therefore, it is suggested that the fact of exposure to cigarette
is not the only one responsible for the presence of telomere shortening. SOURCES OF FUNDING
This
research received no specific grant from any funding agency in the public,
commercial, or not-for-profit sectors. CONFLICT OF INTEREST
The
author have declared that no competing interests exist. ACKNOWLEDGMENT
This study was supported by
CONACYT Grant # SECITI/115/2017. REFERENCES
[1]
Zakian
Va. Telomeres: beginning to understand the end. Science 1995; 270: 1601-7.
[2]
Blackburn
EH. Structure and function of telomeres. Nature 1991; 350: 569-73.
[4]
Counter
CM, Avilion AA, Le Feuvre CL, Stewart NG, Greider CW, Harley CB. Telomere shortening associated with
chromosome instability is arrested in immortal cells which express telomerase
activity. EMBO J. 1992; 11: 1921-9.
[5]
Slijepcevic P, Bryant PE. Chromosome healing, telomere capture and mechanisms of
radiation-induced chromosome breakage. Int J Radiat
Biol 1998; 73: 1-13.
[6]
Alejandra
S.H. Cottliar, Irma. R. Slavutsky. Telomeros
y Actividad de telomerasa: su participacion en el envejecimiento y el desarrollo neoplasico. Buenos
Aires Argentina 2000; 60:335-342
[7]
Sedivy JM. Can ends justify the means? Telomeres and mechanisms of
replicative senescence and immortalization in mammalian cells. Proc Natl Acad Sci USA 1998; 95: 9078-81.
[9]
Verde,
Z., Reinoso- Barbero, L., Chicharro,
L., Garatachea, N., Resano,
P., & Sánchez-Hernandez, I. et al. (2015). Effects of cigarette smoking and
nicotine metabolite ratio on leukocyte telomere length. In Elsevier. Madrid España.
© Granthaalayah 2014-2020. All Rights Reserved. |